90
|
Promega
lenticrisprv2 Lenticrisprv2, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/lenticrisprv2+vector/lenticrisprv2+vectors/pmc07492522-53-3-28 Average 90 stars, based on 1 article reviews
lenticrisprv2 - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
86
|
Hanyin Education Consulting Inc
human fxr1 2 atcttcatctagctcaatgg hanyin biotechnology n a recombinant dna plasmid lenticrisprv2 vector sanjana Human Fxr1 2 Atcttcatctagctcaatgg Hanyin Biotechnology N A Recombinant Dna Plasmid Lenticrisprv2 Vector Sanjana, supplied by Hanyin Education Consulting Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/lenticrisprv2+vector/pm39137727-257-47-41 Average 86 stars, based on 1 article reviews
human fxr1 2 atcttcatctagctcaatgg hanyin biotechnology n a recombinant dna plasmid lenticrisprv2 vector sanjana - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |